THE SEARCH FOR ASSOCIATIONS OF RAINBOW TROUT PERFORMANCE WITH SINGLE NUCLEOTIDE POLYMORPHISMS IN THE EGR1, FAM60A, AND BCL2L11 GENES

Research article
DOI:
https://doi.org/10.23670/IRJ.2023.127.92
Issue: № 1 (127), 2023
Suggested:
05.12.2022
Accepted:
21.12.2022
Published:
24.01.2023
76
0
XML PDF

Abstract

Rainbow trout are one of the most economically valuable aquaculture species in the world. An important economic aspect for rainbow trout farms is the study of genetic markers and marker breeding to improve commercial yields. Evaluation and association of metrics with rainbow trout genotypes will help to cull fish with undesirable growth and developmental abnormalities. The data obtained can improve the breeding efforts of commercial rainbow trout farms. The research provides data on the use of modern statistical approaches to analyse the results of boning and sequencing of rainbow trout DNA samples. As a result of this study, reliable data on the association of SNP genotype in the genes FAM60A, BCL2L11, EGR1 with the metrics of rainbow trout producers, body weight, head length, and body height were revealed.

1. Введение

На сегодняшний день ведется активное развитие аквакультуры, Радужная форель является одним из самых распространённых объектов холодноводных хозяйств товарного рыбоводства. Введение в оборот новых высокопродуктивных пород форели повышает экономическую эффективность рыбоводства. При этом большое внимание уделяется генетическим исследованиям популяций рыб, что обеспечивает паспортизацию пород и поддержание научно-обоснованного уровня генетического разнообразия. Активно развиваются методы изучения геномной архитектуры животных. Радужная форель является важным объектом для научных исследований, т.к. имеет ряд интересных биологических особенной, например, наличие триплоидных и тетраплоидных особей. Появился метод, способный на полногеномном уровне изучать изменчивость и дивергенцию популяций радужной форели

,
,
,
. С помощью чипов стал возможен полногеномный поиск ассоциаций (GWAS, Genome-Wide Association Studies) — направление биологических исследований, связанных с изучением связей между геномными вариантами и фенотипическими признаками. В настоящее время с помощью GWAS анализа изучены ассоциации с интенсивностью роста, срокам созревания и по живой массе лососевых (7; 10 4). Секвенирование генома атлантического лосося сыграло ключевую роль в понимании эволюционных и функциональных последствий, возникающих из-за наследственной дупликации целого генома, характерного для всех представителей семейства Salmonidae. Первым представителем Salmonidae, высококачественная сборка генома которого была опубликована в 2016 году, был атлантический лосось (Salmo salar). Высокопроизводительное секвенирование изменило подход к изучению генетики лосося, в частности, упростило создание наборов маркеров.

Такие признаки как масса тела и длина, у лосося колеблются от низкой до высокой, эти признаки считаются полигенными и включают сотни генов-кандидатов (11 6). Известны несколько генов, которые определяют такой важный в рыбоводстве признак как живая масса. Такими генами являются FAM60A, BCL2L11, EGR1 (9). Первые два из них связаны с регуляцией клеточного цикла, что прямо детерминирует накопление мышечной массы. EGR1, расположенный на 28 хромосоме, являясь транскрипционным фактором, непосредственно регулирует факторы роста, обеспечивая процессы ангиогенеза и накопления мышечной массы. Таким образом, выявление новых аллелей в генах, связанных с развитием мышечной массы является актуальной задачей для совершенствования селекционного процесса при разведении рыб в аквакультуре.

Цель работы: установить связь SNP обнаруженных в экзонах генов FAM60A, BCL2L11, EGR1 с метрическими показателями.

Для решения поставленной цели были сформулированы следующие задачи:

- подобрать праймеры к экзонам генов FAM60A, BCL2L11, EGR1;

- провести секвенирование полученных амплифицированных участков;

- провести статистический анализ полученных результатов.

2. Материалы и методы

Сбор материала проводился на базе Федерального селекционно-генетического центра рыбоводства, который расположен в поселке Ропша Ленинградской области. Объектом исследования служила популяция производителей радужной форели новой породы ропшинская золотая, в возрасте трех лет. С производителей были сняты метрические показатели (масса тела, длина тела по Смиту, длина до конца чешуйчатого покрова, длина головы, высота тела, толщина тела) с помощью мерной доски. Экстракцию ДНК проводили фенольно-детергентным методом с применением протеиназы К для очистки образцов от белков. Оценивали качество и количество ДНК с помощью спектрофотометра NanoDrop 2000, при этом соотношение поглощения при длинах волн 260 нм и 280 нм было не меньше 1,8. Праймеры к изучаемым генам подбирались с помощью сервиса NCBI Primer BLAST. Задавали следующие критерии для праймеров: длина не менее 20 и не более 25 нуклеотидов, GC-содержание в пределах 45-55%, разность в температурах плавления прямого и обратного праймеров не более 1°С и длина амплификата в пределах 500-700 пар оснований. Секвенирование полученных продуктов амплификации проводили с помощью генетического анализатора 3500 Applied Biosystems согласно протоколу производителя. Полученные последовательности были проанализированы и выровнены в программе MEGA X. Достоверность разницы оценивалась с помощью t-критерий (или критерий Стьюдента) по формуле:

img

где p — величина вычисленного эмпирического критерия, который необходимо сравнивать с критическим; M1 и M2 — значения сравниваемых средних арифметических; m1 и m2 — соответствующие величины статистических ошибок средних арифметических.

3. Результаты

В результате анализа базы данных NCBI были подобраны праймеры с помощью сервиса Primer BLAST (Таблица 1).

Таблица 1 - Праймеры используемые для получения продуктов ПЦР для секвенирования

Праймер

Температура отжига °C

Длина фрагмента п.н.

EGR1

F_CAAGGGTCTTCTCTTGAAGCTG

R_CTGCTCCCGAAAGTGGACTG

60

578

BCL2L11

F_TATGGTGGTCAGCCAAGACC

R_CCAGATCCGTGCAGGAAACA

60

654

FAM60A

F_CCATTTGTGGCGGCATTCTC

R_AGATGTTTACTGATTTGCTTGGTGT

60

566

В результате были получены качественные амплифицированные участки методом ПЦР. Состав смеси для проведения ПЦР был следующий: вода 13,6 мкл, буфер 2 мкл, dNTP 2,4 мкл, праймеры прямой и обратный по 0,4 мкл, Taq полимераза 0,4 мкл, ДНК 1 мкл.

Полученные продукты амплификации были секвенированы. В результате проведенного анализа полученных последовательностей были обнаружены: один SNPв экзоне гена EGR1, один SNPв экзоне гена BCL2L11 и 3 SNPв экзоне гена FAM60A. Полученные генотипы были связанны с метрическими показателями рассчитаны средние величины и стандартные ошибки. Полученные результаты занесены в таблицу 2.

Таблица 2 - Распределение средних величин по генотипам рыб

Генотип SNP

Масса гр

Длина тела по Смиту см

Длина тела до конца чешуйчатого покрова см

Длина головы см

Высота тела см

Толщина тела см

EGR1_AA

1880,00±220,00

50,85±2,05

47,40±1,60

10,50±0,50

13,25±0,25a

5,75±0,45

EGR1_AT

1165,00±265,00

43,90±3,10

40,15±2,85

10,10±0,60

11,45±0,45b

4,70±0,60

EGR1_ТТ

1752,50±254,80

47,52±1,88

43,82±1,61

9,75±0,44

13,43±0,87

5,80±0,48

BCL2L11_АA

1480,00±580,00

45,40±4,60

41,65±4,35

9,40±0,10c

12,95±1,95

5,05±0,95

BCL2L11_АG

1757,50±256,20

48,50±1,93

44,65±1,72

10,23±0,34d

13,15±0,83

5,78±0,49

FAM60A_1_AA

1742,36±359,87

47,34±2,69

43,62±2,53

9,76±0,22e

13,30±1,13

5,66±0,69

FAM60A_1_AT

1567,5±92,50

47,40±1,40

44,40±1,40

11,25±0,25f

12,70±0,30

5,25±0,05

FAM60A_1_TT

1586,67±151,69

47,70±2,36

43,70±1,79

9,47±0,65

12,70±0,66

5,63±0,20

FAM60A_2_CT

1599,00±219,68h

46,76±2,13

43,36±1,94

9,76±0,50

12,72±0,72

5,44±0,35

FAM60A_2_TT

1927,50±283,50g

50,00±1,27

45,97±1,09

10,35±0,40

13,85±0,98

6,10±0,59

FAM60A_3_AA

1597,14±245,79

46,64±1,88

43,13±1,77

9,96±0,33

12,67±0,76

5,50±0,48

FAM60A_3_CC

1975,00±85,00

51,05±1,05

46,55±0,55

9,25±0,05

14,45±0,45

6,00±0,00

Примечание: a-b, c-d p-value = 0,05; e-f, g-h p-value = 0,01

В экзоне гена EGR1 был обнаружен один SNP (A/T). Было отмечено, что особи с генотипом АА превосходят особей с генотипом АТ по показателю высота тела (p-value = 0,05). По остальным показателям достоверных различий не было отмечено. 

В экзоне гена BCL2L11 был обнаружен один SNP (A/G). Отмечено, что рыбы с генотипом AG превосходят рыб с генотипом АА по показателю длина головы (p-value = 0,05). По остальным показателям достоверных различий не было отмечено.

В экзоне гена FAM60A(SINHCAFL) били обнаружены три однонуклеотидных (А/Т, С/Т, А/С). В первом SNP (А/Т) особи с генотипом АА превосходили особей с генотипом АТ по показателю длина головы (p-value= 0,01). Рыбы с генотипом АT превосходили рыб с генотипом ТТ по показателю длина головы (p-value=0,05). Во втором SNP у особей с генотипом ТТ превосходили особей с генотипом СТ по массе тела (p-value= 0,01). В третьем SNP не было обнаружено достоверной разницы. Очевидно, при отборе производителей лучше использовать генотипы с учетом указанных SNP сразу по трем генам, что повысит эффект селекционной работы с рыбой.

4. Заключение

В результате проведенного исследования были обнаружены достоверные данные о связи генотипа SNP в генах FAM60A, BCL2L11, EGR1 с отдельными метрическими показателями производителей радужной форели. На основании полученных данных можно вести маркерную селекцию с подбором производителей радужной форели с целью улучшения продуктивных показателей у потомков.

Article metrics

Views:76
Downloads:0
Views
Total:
Views:76