Pages Navigation Menu

ISSN 2227-6017 (ONLINE), ISSN 2303-9868 (PRINT), DOI: 10.18454/IRJ.2227-6017
ПИ № ФС 77 - 51217, 16+

DOI: https://doi.org/10.23670/IRJ.2017.55.087

Скачать PDF ( ) Страницы: 102-106 Выпуск: № 01 (55) Часть 1 () Искать в Google Scholar
Цитировать

Цитировать

Электронная ссылка | Печатная ссылка

Скопируйте отформатированную библиографическую ссылку через буфер обмена или перейдите по одной из ссылок для импорта в Менеджер библиографий.
Гараева Л. А. АССОЦИАЦИЯ ПОЛИМОРФНЫХ ЛОКУСОВ ГЕНОВ ПРОВОСПАЛИТЕЛЬНЫХ ЦИТОКИНОВ У ПАЦИЕНТОВ С КОРОНАРНЫМ И ПЕРИФЕРИЧЕСКИМ АТЕРОСКЛЕРОЗОМ РАЗЛИЧНОЙ СТЕПЕНИ ТЯЖЕСТИ / Л. А. Гараева, С. Д. Маянская // Международный научно-исследовательский журнал. — 2017. — № 01 (55) Часть 1. — С. 102—106. — URL: https://research-journal.org/medical/associaciya-polimorfnyx-lokusov-genov-provospalitelnyx-citokinov-u-pacientov-s-koronarnym-i-perifericheskim-aterosklerozom-razlichnoj-stepeni-tyazhesti/ (дата обращения: 25.03.2019. ). doi: 10.23670/IRJ.2017.55.087
Гараева Л. А. АССОЦИАЦИЯ ПОЛИМОРФНЫХ ЛОКУСОВ ГЕНОВ ПРОВОСПАЛИТЕЛЬНЫХ ЦИТОКИНОВ У ПАЦИЕНТОВ С КОРОНАРНЫМ И ПЕРИФЕРИЧЕСКИМ АТЕРОСКЛЕРОЗОМ РАЗЛИЧНОЙ СТЕПЕНИ ТЯЖЕСТИ / Л. А. Гараева, С. Д. Маянская // Международный научно-исследовательский журнал. — 2017. — № 01 (55) Часть 1. — С. 102—106. doi: 10.23670/IRJ.2017.55.087

Импортировать


АССОЦИАЦИЯ ПОЛИМОРФНЫХ ЛОКУСОВ ГЕНОВ ПРОВОСПАЛИТЕЛЬНЫХ ЦИТОКИНОВ У ПАЦИЕНТОВ С КОРОНАРНЫМ И ПЕРИФЕРИЧЕСКИМ АТЕРОСКЛЕРОЗОМ РАЗЛИЧНОЙ СТЕПЕНИ ТЯЖЕСТИ

Гараева Л.А.1, Маянская С.Д.2

1ORCID: 0000-0002-9427-6037, Аспирант,

ФГБОУ ВО Казанский государственный медицинский университет

2ORCID: 0000-0001-6701-5395, Доктор медицинских наук, профессор,

ФГБОУ ВО Казанский государственный медицинский университет

АССОЦИАЦИЯ ПОЛИМОРФНЫХ ЛОКУСОВ ГЕНОВ ПРОВОСПАЛИТЕЛЬНЫХ ЦИТОКИНОВ У ПАЦИЕНТОВ С КОРОНАРНЫМ И ПЕРИФЕРИЧЕСКИМ АТЕРОСКЛЕРОЗОМ РАЗЛИЧНОЙ СТЕПЕНИ ТЯЖЕСТИ

Аннотация

Проведено исследование ассоциации полиморфных локусов генов TNFa (rs1800629) и IL-1b (rs16944) с тяжестью течения атеросклеротического процесса. Изучалось распределение диких аллелей -308-A гена  TNFa и -511-T гена IL-1b в группах пациентов с коронарным и периферическим атеросклерозом, разделенных по данным ангиографии и клиническим проявлениям. Установлено, что наличие -308-A аллеля гена  TNFa значимо ассоциируется с более легким течением заболевания, а также более редким развитием инфаркта миокарда. Полиморфизм гена IL-1b (rs16944) не ассоциировался ни с одним из изучаемых параметров. Результаты исследования предполагают наличие протективной роли -308-A аллеля гена  TNFa в развитии тяжелого течения атеросклероза.

Ключевые слова: атеросклероз, ген-кандидат, полиморфизм, цитокины, TNFa, IL-1b.

Garaeva L.A.1, Mayanskaya S.D.2

1ORCID: 0000-0002-9427-6037, Postgraduate stuent,

FSBEI HE Kazan State Medical University

2ORCID: 0000-0001-6701-5395, MD, Professor

FSBEI HE Kazan State Medical University

ASSOCIATION OF PRO-INFLAMMATORY CYTOKINE GENE POLYMORPHISMS WITH SEVERE CORONARY AND PERIPHERAL ATHEROSCLEROSIS

Abstract

The purpose of the study was to investigate association of TNFa (rs1800629) and IL-1b (rs16944) gene polymorphisms with severity of atherosclerotic process. We studied distribution of -308-A TNFa and -511-T IL-1b wild alleles in patients with coronary and peripheral atherosclerosis, divided into groups by angiographic and clinical data. It was found that presence of TNFa -308-A allele was significantly associated with milder disease, as well as rare myocardial infarction. IL-1b rs16944 polymorphism has not shown any association with parameters presented. The study results suggest a protective role for TNFa -308-A allele against severe courses of atherosclerosis.

Ключевые слова: atherosclerosis, candidate gene, polymorphism, cytokines, TNFa, IL-1b.

Фатальные осложнения атеросклеротического процесса являются главной причиной смертности во всех развитых странах.  Воспаление вносит существенный вклад в атеросклеротический процесс со стадии инициации поражения сосудистой стенки до дестабилизации и повреждения атеросклеротической бляшки [1, 2]. Существенной частью воспалительного процесса в стенке сосуда является проникновение моноцитов и Т-клеток в интиму. Данный процесс требует активации эндотелия и экспрессии им молекул адгезии лейкоцитов: VCAM-1, ICAM-1 и MCP-1 [3].

Как известно, интерлейкин – 1β (IL-1β) и tumor necrosis factor a (TNFa), оба, являются цитокинами, стимулирующими как активацию эндотелия, так и экспрессию молекул адгезии эндотелием, а также гладкомышечными клетками, моноцитами и макрофагами. Помимо этого они стимулируют дальнейшую активацию макрофагов, ингибируют липопротеинлипазу, повышают системный уровень липопротеидов низкой плотности (ЛПНП) и триглицеридов (ТГ). Воспалительный каскад TNFa и IL-1 приводит к экспрессии  интерлейкина-6, секреции пентраксинов, в частности С-реактивного белка [4].

Полиморфизм генов TNFa и IL-1b, вовлеченных  в процессы иммунной реакции, может быть причиной повышенного уровня экспрессии цитокинов и развития аномальной или преувеличенной воспалительной реакции, что отражается на тяжести течения атеросклеротического процесса [5]. Изучение «генов-кандидатов» позволит дополнить существующие подходы к стратификации риска у больных с атеросклерозом, сделав их максимально персонифицированными.

По данным литературы наибольший интерес представляет полиморфный локус rs1800629 гена  TNFa. Предполагается, что в стимулированных T-клетках экспрессия его в два раза выше при наличии -308A аллеля [6].

Ген ILb также имеет несколько полиморфных локусов, наиболее значимым из которых считается rs16944. Показано, что редкий аллель -511T увеличивает уровень секреции IL-1b в ответ на стимулирование липополисахаридами (LPS) [7].

В настоящем исследовании мы оценили ассоциацию полиморфных локусов генов TNFa (rs1800629) и IL-1b (rs16944) с тяжестью течения атеросклеротического процесса.

Материалы и методы

Были обследованы 305 человек в возрасте от 44 до 73 лет с атеросклерозом различной локализации, находившиеся на стационарном лечении в сосудистом отделении №1 ГАУЗ «Республиканская клиническая больница» МЗ РТ, а также в кардиологических отделениях ГАУЗ “Городская клиническая больница №7” г. Казани. Пациентам проводилась ангиография сосудов брюшной части аорты, нижних конечностей, ветвей дуги аорты, коронароангиография, оценивался липидный профиль. У всех пациентов был взят образец венозной крови для генотипирования.

Часть пациентов не вошли в исследование из-за наличия тяжелых сопутствующих поражений, которые могут оказать влияние на тяжесть течения атеросклероза – терминальная стадия почечной или печеночной недостаточности, тяжелая форма сахарного диабета, иммунодефицитное состояние. Полная клинико-лабораторная характеристика обследованных пациентов отображена в таблице 1.

Таблица 1 – Клиническая характеристика пациентов (n=219).

Мужчины, n (%) / Женщины, n (%) 140 (63,9) / 79 (36,1)
Возраст, лет (M±SD) 66±10,7
Национальность

татары, n (%)

русские, n (%)

смешанные, n (%)

др.*, n (%)

 

89 (40,6)

91 (41,6)

32 (14,6)

7 (3,2)

Наличие гипертонической болезни, n (%) 169 (77,2)
Наличие ИБС, n (%) 171 (78,1)
Наличие периферического атеросклероза различной локализации, n (%)  

129 (58,9)

Наличие перенесенного ИМ, n (%) 113 (51,5)
Наличие окклюзии одного или нескольких участков периферических сосудов, n (%)  

81 (36,9)

Наличие неокклюзирующих поражений периферических сосудов с выраженной ишемической симптоматикой (стенозы более 70%):

одного бассейна, n (%)

двух и более бассейнов, n (%)

 

 

 

44 (20,1)
25 (11,4)

* – башкиры, чуваши, болгары, грузины; ИБС – ишемическая болезнь сердца; ИМ – инфаркт миокарда

 Для молекулярно-генетического исследования ДНК выделяли из венозной крови с использованием стандартной процедуры.

 Генотипирование однонуклеотидных полиморнфых локусов (ОНП) rs1800629 гена TNFa и rs16944 гена IL1b проводили с помощью реакции преципитации (ПЦР) в режиме реального времени с использованием конкурирующих TaqMan-зондов. Были использованы следующие олигонуклеотиды, комплементарные полиморфным участкам ДНК:  для rs1800629 гена TNFa – 5’- TTCCGAGGGGGGTCTTCTG -3’ и 5’- GTTCTATCTTTTTCCTGCATCCTGT -3’; для rs16944 гена IL1b – 5’-FAM-CCCGTCCTCATGCCC-RTQ-3’и 5’-R6G-CCCGTCCCCATGCCC-FQ-3’.

Статистический анализ. Использовали стандартный описательный и сравнительный анализ. Соответствие равновесию Харди-Вайнберга оценивали с помощью точного теста Фишера (http://ihg.gsf.de/cgi-bin/hw/hwa1.pl). Ассоциацию генотипов ОНП с тяжестью атеросклероза и его клиническими проявлениями исследовании с помощью логистического регрессионного анализа, реализованного в функции “glm” программного обеспечения R-project для статистического анализа (www.r-project.org). Анализ проводили для аддитивной модели; высокий уровень общего холестерина и наличие гипертензии были закодированы бинарно. Критический уровень значимости принимали равным 0,05. После поправки Бонферрони на множественные сравнения значимыми считали результаты с P<0,004. Вычисление ассоциации генотипов локуса rs1800629 гена TNFa дополнительно оценивали с помощью фактора Байеса (BF, Bayes Factor), ввиду того, что в группе пациентов с повторным инфарктом были представители только одного генотипа. Порогом значимости считали величину 10 – свидетельство в пользу гипотезы H1 против гипотезы H0 – вычисленное как отношение вероятности альтернативной гипотезы к вероятности нулевой гипотезы.

Результаты

Все пациенты с коронарным и периферическим атеросклерозом были поделены на две группы сравнения в зависимости от тяжести течения заболевания.

 В первую группу вошли пациенты имеющие как минимум одну полную окклюзию сосуда любого бассейна (по данным ангиографии периферических сосудов и коронароангиографии) и/или гемодинамически выраженный стеноз (более 70% по данным ангиографии) сосудов двух и более бассейнов. Эта группа была условно названа группой с тяжелым течением заболевания.

   Во вторую группу были включены пациенты с ИБС без перенесенного ИМ и пациенты с периферическим атеросклерозом, имеющие более легкие клинически выраженные стенозы (менее чем на 70 % по данным ангиографии), либо пациенты с выраженными ишемическими изменениями (стеноз более 70%) только в одном бассейне (Таблица 2).

  Таблица 2 – Критерии включения в группы сравнения.

  Первая группа

(пациенты с более тяжелым течением атеросклероза)

Вторая группа

(пациенты с более легким течением атеросклероза)

Стеноз более 70% 2 и более сосуда не более 1 сосуда
Окклюзия 1 и более сосуда нет
Острый инфаркт миокарда (ОИМ) (в том числе и перенесенный) да нет

Кроме этого нами изучались группы пациентов с клиническими проявлениями атеросклероза в виде наличия в анамнезе или на момент обследования ИМ и по сравнению с пациентами без фатальных осложнений ишемической болезни сердца, а также отдельно пациенты с повторным ИМ по сравнению с пациентами без такового.

Встречаемость -308 A аллеля гена TNFa в выборке рассчитывалась путем сложения генотипов GA+AA. Наличие -511 T аллеля полиморфного локуса rs16944 гена IL1b определяли в генотипах С/Т +Т/Т.

 Распределение частот встречаемости ОНП в общей группе соответствует распределению Харди-Вайнберга: rs1800629 гена TNFa (p=1.00) и rs16944 гена IL1b (p=0.24).

Ассоциацию полиморфных локусов rs1800629 гена TNFa и rs16944 гена IL1b с клиническими проявлениями атеросклероза мы исследовали с помощью логистического регрессионного анализа (Таблица 3).

В виду значимости гиперхолестеринемии и гипертензии для инициации воспалительного процесса, помимо стандартных поправок на пол и возраст, в регрессионную модель были введены поправки на высокий уровень общего холестерина и наличие гипертензии.

Таблица 3 – Распределение полиморфных локусов rs1800629 гена TNFa и rs16944 гена IL1b в группах сравнения, n=214 (%).

    Первая группа, n=166 Вторая

группа, n=53

OR, 95% C.I., P
Генотипы

rs1800629 гена TNFa

G/G 137 (82,5) 39 (73,5) 0,22 (0,07-0,65)

P=0,006

G/A+A/A 29 (17,5) 14 (26,4)
Генотипы

rs16944 гена IL1b

C/C 68 (40,9) 28 (52,8) 1,59 (0,76-3,35) P=0,22
C/T+T/T 98 (59,1) 25 (47,2)
    ОИМ, n=114 Нет ОИМ, n=105  
Генотипы

rs1800629 гена TNFa

G/G 102 (89,4) 74 (70,4) 0,15 (0,06-0,38) P=0,00006
G/A+A/A 12 (10,6) 31 (29,6)
Генотипы

rs16944 гена IL1b

C/C 48 (42,1) 48 (45,7) 1,27 (0,75-2,14) P=0,37
C/T+T/T 66 (57,9) 57 (54,3)
    Повторный ИМ, n=24 Нет повторного ИМ, n=195  
Генотипы

rs1800629 гена TNFa

G/G 24 (100) 152 (78) 0 [0,0] P=0,98

BF=33

G/A+A/A 0 (0) 43 (22)
Генотипы

rs16944 гена IL1b

C/C 8 (33,3) 88 (45,1) 1,69 (0,87-3,30) P=0,12
C/T+T/T 16 (66,6) 107 (54,9)

OR – отношение шансов, 95%C.I. – отношение средних значений, определенных методом наименьших квадратов, с доверительным интервалом 95%,  P– уровень значимости, BF-фактор Байеса.

Исходя из данных таблицы видно, что нами была выявлена ассоциация полиморфного локуса rs1800629 (-308 A) гена TNFa с более легким течением атеросклероза (аллель А: OR=0,22, 95%C.I.=(0,07-0,65), P=0,006).

Кроме того А аллель также значимо ассоциировалась с более редким возникновением как инфаркта миокарда в целом (0,15 (0,06-0,38) P=0,00006), так и с его повторением (BF=33).

При этом гомозиготный генотип А-308 A наблюдался только в пяти случаях, что не позволяет делать выводы о его влиянии на какие-либо параметры. Гомозиготный генотип G-308 G не показал достоверной связи с более тяжелым течением заболевания, однако наблюдается тенденция к увеличению частоты его встречаемости в группе больных, имеющих окклюзии и тяжелые стенозы.

Статистически значимой ассоциации rs1800629 с другими параметрами, такими как пол, гипертония, уровень холестерина, индекс массы тела и национальность, выявлено не было.

Для полиморфного локуса rs16944 гена IL1b нами не обнаружено ассоциации ни с одним из изучаемых параметров.

Обсуждение

Атерогенный эффект таких провоспалительных цитокинов как TNFa и IL1b достаточно широко изучен.

На мышах неоднократно было показано, что TNFa стимулирует прогрессирование атеросклеротической бляшки в нестабильный тип с развитием внутри очагов кровоизлияния [8].

В исследованиях на людях имеется множество данных, фиксирующих связь повышенного уровня цитокина с различными клиническими проявлениями атеросклероза [9].

Kroeger et al. в 1997 году выявили, что уровень экспрессии TNFa в стимулированных митогеном PMA T-клетках в два раза выше при наличии дикого -308A аллеля. [6].  Это приводит к предположению, что наличие -308A аллеля должно ассоциироваться с высокой частотой возникновения атеросклероза, а также его фатальных осложнений.

Однако, наличие -308A аллеля у наших пациентов коррелировало не только с меньшим количеством и размерами атеросклеротических бляшек по данным ангиографии, но и являлось протективным фактором в отношении развития однократного и повторных ИМ. Подобные наблюдения могут объясняться несколькими причинами.   Необходимо отметить, что несмотря на довольно противоречивые данные большинство исследователей все-таки приходят к выводу, что наличие полиморфного -308A  аллеля не является отягчающим обстоятельством в отношении различных клинических форм атеросклероза.  [10].

Gabor et. al. в своем исследовании пришли к выводу, что существенным влиянием на уровень цитокина в крови, а также инициацию и прогрессирование атеросклероза обладает не аллель, а генотип А-308A [11].  В нашем исследовании мы не можем оценить подобное предположение, поскольку встречаемость этого крайне редкого генотипа среди наших пациентов слишком мала для изучения достоверных отличий.

Помимо этого имеются данные о существенной неравнозначности влияния полиморфизма rs1800629 в различных популяциях. Так, в исследовании о взаимосвязи полиморфизма с сахарным диабетом 2 типа было обнаружено, что эта связь четко прослеживается во всех популяциях, кроме индийской и тунисской [12].  Кроме этого все наблюдения полиморфизма у больных с атеросклерозом в индийской, а также китайской популяциях отвергают какие-либо ассоциации [13, 14].  Можно предположить, что подобная модель характерна и для населения Поволжского региона.

Такие предположения, однако, не объясняют полученных нами данных о протективной роли полиморфного локуса.

Несмотря на многочисленные данные об однозначно провоспалительной роли TNFa, в последние годы стали появляться сведения о его возможном участии в защитных механизмах при некоторых поражениях сердечно-сосудистой системы.

Биологическая активность TNF-a реализуется в сочетании его с TNF-a-рецептором (TNFR), который экспрессируется в клеточных мембранах. Этот рецептор представлен двумя типами – TNFR1 и TNFR2. При взаимодействии с рецептором первого типа фактор некроза опухоли проявляет все свои провоспалительные свойства, участвуя в патологических механизмах, связанных с атерогенезом, после ИМ приводя к ремоделированию желудочков, апоптозу кардиомиоцитов и кардиотоксическому эффекту [15].

В то же время при комбинировании TNF-a с рецептором второго типа, он ингибирует воспалительную реакцию, уменьшает ремоделирование и улучшает систолическую функцию, оказывая кардиопротективный эффект. [16]. Помимо этого TNF-a в небольших дозах снижает накопление Ca2+ кардиомиоцитами, улучшает функцию митохондрий в поврежденных сердечных клетках и уменьшает секрецию лептина, способствуя восстановлению после повреждения [17].

Надо отметить, что экспрессия TNFR2 зависит от возраста и степени повреждения сердечно-сосудистой системы [18].  Поэтому наше предположение состоит в том, что, возможно, атеропротективный эффект -308A аллеля, влияющего на экспрессию TNF-a и предположительно его взаимодействие с рецепторами, будет проявляться в отношении именно развития более тяжелого течения заболевания.

Абсолютное большинство  исследований полиморфного локуса rs1800629 (-308A) изучают частоту развития различных проявлений атеросклероза в популяции по сравнению со здоровыми людьми, что характеризует связь полиморфизма с возможностью инициации заболевания, а не его влияние на характер течения. [9, 13, 14, 19].

В нескольких исследованиях у пациентов с разными формами течения ИБС в отличие от нашего разницы по полиморфизму -308A аллели не было. Возможно это связано с тем, что в них рассматривались группы пациентов, различные по степени тяжести  атеросклеротического поражения сосудов. Так Suri et al, обозначали наличие стеноза хотя бы одного сосуда более 50% по данным ангиографии как тяжелую форму заболевания [14].  Предполагая протективную роль полиморфизма при развитии тяжелых форм течения атеросклероза, возможно необходимо рассматривать значительно более тяжелые поражения.

И наконец помимо защитного влияния самого фактора некроза опухоли, возможно необходимо рассмотреть влияние полиморфизма rs1800629 на другие гены.

Недавно было обнаружено, что rs1800629 является «expression quantitative trait loci» – локусом, влияющим на транскрипцию – для гена AIF1. Этот белок, широко представленный в атеросклеротических бляшках, усиливает пролиферацию гладкой мускулатуры сосудов, а также способствует активации и пролиферации эндотелия [20].  Можно предположить, что полиморфизм генотипа G-308A снижает экспрессию этого белка, оказывая таким образом антиатерогенный эффект.

IL1b также представлен как мощный провоспалительный цитокин, во многих случаях выступая синергитически с TNFa. Поэтому представлялось интересным оценить влияние его полиморфизма rs16944 на тяжесть течения атеросклероза в одной выборке пациентов. Предполагается, что наличие дикого -511-Т аллеля в несколько раз увеличивает его экспрессию, что, соответственно, может влиять на атерогенез [7]. Имеется некоторое количество исследований, как подтверждающих эту теорию [21], так и отрицающих какую-либо взаимосвязь rs16944 (-511-Т) полиморфизма с атеросклерозом [22].  Однако, нами не было обнаружено связи между тяжестью течения заболевания и полиморфизмом данного гена.

Заключение. Таким образом, в нашем исследовании было обнаружено наличие протективной роли -308A аллеля гена TNFa как в отношении тяжести и количества атеросклеротических поражений по данным ангиографии, так и в отношении частоты развития ИМ и повторного ИМ, что может говорить о защитных свойствах как самого фактора некроза опухоли- альфа, так и его полиморфизма при развитии более тяжелых форм заболевания, а также о возможном отрицательном влиянии гомозиготного G-308G на поздних этапах атеросклеротического поражения. Нами не было обнаружено связи полиморфизма rs16944 гена IL1b ни с одним из изучаемых параметров. Учитывая абсолютно противоречивые данные литературы, требуются дополнительные исследования влияния полиморфизма rs1800629 гена TNFa на тяжесть течения атеросклеротического поражения.

Список литературы / References

  1. Aukrust P. et al. Inflammation in coronary artery disease: potential role for immunomodulatory therapy / P. Aukrust et al. // Expert Review of Cardiovascular Therapy Journal. – 2005. – Vol. 3(6). – P. 1111–1124. doi:10.1586/14779072.3.6.1111
  2. Huang J. et al. Genome-wide association study for circulating levels of PAI-1 provides novel insights into its regulation / J. Huang et al. // Blood Journal. – 2012. – Vol. 120(24). – P. 4873–4881. doi:10.1182/blood-2012-06-436188
  3. Cybulsky M. I. et al. Endothelial expression of a mononuclear leukocyte adhesion molecule during atherogenesis / I.M. Cybulsky et al. // Science Journal. – 1991. – Vol. 251(4995). – P. 788–791.
  4. Hansson G. K. Immune mechanisms in atherosclerosis / G.K. Hansson // Arteriosclerosis Thrombosis and Vascular Biology Journal. – 2001. – Vol. 21(12). – P. 1876–1890. doi:https://doi.org/10.1161/hq1201.100220
  5. Oda K. et al. Polymorphisms in pro- and anti-inflammatory cytokine genes and susceptibility to atherosclerosis: A pathological study of 1503 consecutive autopsy cases / K. Oda et al. // Human Molecular Genetics Journal. – 2007. – Vol. 16(6). – P. 592–599. doi:10.1093/hmg/ddl483
  6. Kroeger K. M. et al. The -308 tumor necrosis factor-alpha promoter polymorphism effects transcription / K.M. Kroeger et al. // Molecular Immunology Journal. – 1997. – Vol. 34(5). – P. 391–399.
  7. Chen H. et al. Single nucleotide polymorphisms in the human interleukin-1B gene affect transcription according to haplotype context / H. Chen et al. // Human Molecular Genetics Journal. – 2006. – Vol. 15(4). – P. 519–529. doi: 10.1093/hmg/ddi469
  8. Tay C. et al. B-cell-specific depletion of tumour necrosis factor alpha inhibits atherosclerosis development and plaque vulnerability to rupture by reducing cell death and inflammation / C. Tay et al. // Cardiovascular Research Journal. – 2016. – Vol. 111(4). – P. 385-97. doi: 10.1093/cvr/cvw186
  9. Bennet A. M. et al. Association of TNF-alpha serum levels and TNFA promoter polymorphisms with risk of myocardial infarction / A. M. Bennet et al. // Atherosclerosis Journal. – 2006. – Vol. 187(2). – P. 408-414. doi: 10.1016/j.atherosclerosis.2005.09.022
  10. Hua X. P. et al. Association between TNF-α rs1800629 polymorphism and the risk of myocardial infarction: A meta-analysis / X. P. Hua et al. // Genetics and Molecular Research Journal. – 2016. – Vol. 15(3). doi:10.4238/gmr.15037292
  11. Gábor V. S. et al. Тumornecrosis-Factor-α 308 GA Polymorphism in Atherosclerotic Patients / V. S. Gabor // Pathology & Oncology Research Journal. -2011. – Vol. 17(4). – P. 853–857. doi:10.1007/s12253-011-9393-8
  12. Luna G.I. et al. Association between -308G/A TNFA Polymorphism and Susceptibility to Type 2 Diabetes Mellitus: A Systematic Review / G.I. Luna et al. // Journal of Diabetes Research. – 2016. –Vol. 2016(2016). doi:10.1155/2016/6309484
  13. Hou L. et al. Polymorphisms of tumor necrosis factor alpha gene and coronary heart disease in a Chinese Han population: interaction with cigarette smoking / L. Hou et al. // Thrombosis Research Journal. – 2009. – Vol. 123(6). – P. 822-828. doi:10.1016/j.thromres.2008.07.016
  14. Suri A. et al. Study of TNF-α Polymorphism (308G/A) and the Role of NF-κB as an Novel Marker of Severity of Atherosclerosis: A Pilot Study in Indian Population / A. Suri et al. // Journal of Molecular Biomarkers & Diagnosis. – 2016. – Vol. 7(287). doi:10.4172/2155-9929.1000287
  15. Torre-Amione G. et al. Expression and functional significance of tumor necrosis factor receptors in human myocardium / G. Torre-Amione et al. // Circulation Journal. – 1995. – Vol. 92(6). – P. 1487–1493.
  16. Nilsson L. et al. Soluble TNF receptors are associated with infarct size and ventricular dysfunction in ST-elevation myocardial infarction / L. Nilsson et al. // PLoS ONE Journal. – 2013. – Vol. 8(2). – P. e55477. doi:10.1371/journal.pone.0055477
  17. Lacerda L. et al. Influence of tumour necrosis factor alpha on the outcome of ischaemic postconditioning in the presence of obesity and diabetes / L. Lacerda et al. // Experimental Diabetes Research Journal – 2012. doi:10.1155/2012/502654
  18. Kishore R. et al. Tumor necrosis factor-alpha signaling via TNFR1/p55 is deleterious whereas TNFR2/p75 signaling is protective in adult infarct myocardium / R. Kishore et al. // Advances in Experimental Medicine and Biology Journal. – 2011. – Vol. 691. – P. 433–448. doi:10.1007/978-1-4419-6612-4_45
  19. Biswas S. et al. Synergistic effect of anti and pro-inflammatory cytokine genes and their promoter polymorphism with ST-elevation of myocardial infarction / S. Biswas et al. // Gene Journal. – 2014. – Vol. 544(2). – P. 145-151. doi: 10.1016/j.gene.2014.04.065
  20. Tian Y. et al. AIF-1 expression regulates endothelial cell activation , signal transduction , and vasculogenesis / Y. Tian et al. // Cardiovascular Research Journal. – 2009. – Vol. 296(2). – P. 256–C266. doi:10.1152/ajpcell.00325.2008
  21. Dziedzic T. et al. Interleukin 1 Beta Polymorphism (–511) and Risk of Stroke due to Small Vessel Disease / T. Dziedzic et al. // Cerebrovascular Disease Journal. – 2005. – Vol. 20(5). – P. 299-303. doi:10.1159/000087928
  22. Soylu O. et al. Interleukin-1B (-511) gene polymorphism is associated with acute coronary syndrome in the Turkish population / O. Soylu et al. // European Cytokine Network Journal. – 2008. – Vol. 19(1). – P. 42-8. doi:10.1684/ecn.2008.0119

Оставить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *

Лимит времени истёк. Пожалуйста, перезагрузите CAPTCHA.