SELECTION OF BROOD FISH AND ACCOUNTING OF HEIGHT AND WEIGHT PARAMETERS IN RAINBOW TROUT OF A NEW BREEDING FORM - GOLDEN TROUT

Research article
DOI:
https://doi.org/10.23670/IRJ.2022.122.41
Issue: № 8 (122), 2022
Suggested:
14.07.2022
Accepted:
05.08.2022
Published:
17.08.2022
1926
6
XML
PDF

Abstract

The article addresses the issues of creating a database on the height and weight parameters of brood fish and their offspring in rainbow trout. The work was carried out with a new selection form, the Ropshin golden trout. 17 pairs of brood fish were selected from which offspring was offspring, and 50 specimens from offspring of each pair were sampled monthly during 6 months with data entry in Excel spreadsheets. Males (age 4 years), females (age 2 years) and offspring were counted in accordance with many breeding-relevant parameters. A high variability of traits between specimens was observed, which is a characteristic trait of rainbow trout. The database created is the basis for identifying links between phenotypic traits in offspring and parental genotypes, identified by sequenation of two genes, BMP-2 and LCORL. The work in this part will be carried out in the coming years.

1. Введение

Семейство лососевых рыб является одним из самых известных и экономически важных видов рыб в мире. Мясо лососевых является важным питательным пищевым продуктом для потребления человеком [1]. Аквакультура вносит значительный вклад в продовольственную и экономическую безопасность во многих странах [2], а также является предметом генетических исследований [3], [4]. Интерес представляет новое селекционное достижение – Ропшинская золотая форель, характеризующаяся привлекательной окраской чешуйчатого покрова  [5].

В последние годы особое внимание уделяется исследованию генома как ключевого фактора к пониманию функционирования клеток животных, растений и бактерий. Используется целый ряд методических подходов к расшифровке структуры генома, такие как изучение распределения микросателлитных ДНК в геноме [6], полиморфизм рестрикционных фрагментов ДНК [7] и секвенирование целого генома либо отдельных его участков [8]. Секвенирование генома атлантического лосося сыграло ключевую роль в понимании эволюционных и функциональных последствий, возникающих из-за наследственной дупликации целого генома, характерного для всех представителей семейства Salmonidae. Первым представителем семейства, высококачественная сборка генома которого была опубликована в 2016 году, был атлантический лосось (Salmo salar). Высокопроизводительное секвенирование изменило подход к изучению генетики лосося, в частности, упростило создание наборов маркеров. Генами, влияющими на рост и увеличение мышечной массы, являются LCORL и BMP-2 [9]. В хромосоме 24 расположен ген костного морфогенетического белка 2 (BMP-2), связанный с действием факторов роста, который играет роль в развитии тканей скелетных мышц Известно, что ген проявляет максимальную экспрессию в мышцах рыб семейства карповых. Полиморфизмы в этом гене связывают с формированием костей и размером скелета. Большинство животных несет одну копию гена BMP-2, в то же время костистые рыбы имеет две копии [10]. Ген LCORL у животных и рыб мало изучен. Этот ген кодирует лиганд-зависимый ядерный рецепторный корепсореподобный белок и является транскрипционным фактором. LCORL влияет не только на рост мышечной ткани у взрослой особи, но и на развитие мышц и скелета в эмбриогенезе.

Для выявления ассоциаций между полиморфными вариантами указанных генов и продуктивными характеристиками рыб необходимо создать базу данных, содержащую сведения о производителях и их потомках. Обобщение этих данных и сведение результатов бонитировки в базу данных явилось целью данной работы.

2. Методы и принципы исследования

Объект исследования

Сбор биологического материала проводился на базе Федерального Селекционно-генетического центра рыбоводства, который расположен в поселке Ропша, Ленинградская область. Объектом исследования была популяция радужной форели породы ропшинская золотая. Для индивидуальной закладки икры на инкубацию были подобраны 17 пар производителей, количество изученных потомков составляло по 50 особей от каждой пары производителей (из 17 пар производителей потомство изучали от восьми пар). Самки были в возрасте четырех лет, а самцы в возрасте двух лет. Список сочетаний самок и самцов, от которых изначально планировалось получить потомство, представлен в таблице 1.

Таблица 1 - Схема пар производителей

№ Самки

№ Самца (Пробирки)

№ Рамки

283

1

48

281

2

50

280

3

5х2

284

4

41

285

5

101

286

6

47

287

7

40

288

8

49

290

9

4х2

289

10

100

294

11

11

297

12

60

293

13

12

298

14

59

292

15

53

295

16

23

300

20

24

 Учет размерно-весовых показателей

От производителей во время бонитировки были взяты образцы биологического материала (кусок ткани), который был зафиксирован в 96% спирте.  Для закладки на инкубацию от самок было отобрано по 100 грамм икры. Осеменение производилось сухим методом. Далее икра была заложена в инкубационные аппараты. В процессе инкубации погибшая икра выбраковывалась. За время инкубации в двух семьях количество погибшей икры достигло 100%. Средняя температура инкубации составляла 9 °С. В процессе вылупления личинок и инкубационных рамок удалялась оболочка икры для избежания образования сапролегнии. К моменту перехода личинки на активное внешнее питание в 10 семьях из 18 оставшихся отход составил 100%.  С мальков от каждой семьи снимались метрические показатели (масса, длина по Смиту, длина до конца чешуйчатого покрова, длина головы, высота и толщина тела), с интервалом в месяц в течении полугода, для контроля роста и развития. При помощи мерной доски с самок были сняты размерно-весовые показатели (масса, длина по Смиту, длина до конца чешуйчатого покрова, длина головы, высота и толщина тела), а также репродуктивные показатели (вес икры, полученный от самки, масса одной икринки, количество икры в 5 граммах) на нерестовой бонитировке.

С самцов были взяты масса тела, длина по Смиту, объем эякулята, подвижность спермы (сек/%). От производителей во время бонитировки были взяты образцы биологического материала (кусок ткани), который был зафиксирован в 96% спирте. Для закладки на инкубацию от самок было отобрано по 100 грамм икры. Осеменение производилось сухим методом. Далее икра была заложена в инкубационные аппараты. В процессе инкубации погибшая икра выбраковывалась. За время инкубации в двух семьях количество погибшей икры достигло 100%. Средняя температура инкубации составляла 9°С. В процессе вылупления личинок из инкубационных рамок удалялась оболочка икры для избежания образования сапролегнии. К моменту перехода личинки на активное внешнее питание в 10 семьях из 18 оставшихся отход составил 100%.  С мальков от каждой семьи снимались метрические показатели (масса, длина по Смиту, длина до конца чешуйчатого покрова, длина головы, высота и толщина тела), с интервалом в месяц в течении полугода, для контроля роста и развития. Выделение геномной ДНК производителей проводилась фенольным методом в лаборатории. Были подобраны праймеры к дублированному гену BMP-2 (костный морфогенетический белок 2) на 4 и 24 хромосоме.

Проведение ПЦР

Дизайн ПЦР праймеров, специфичных для определенных участков генов BMP-2 и LCORL, проводили по онлайн программе Primer 3 Plus (см. таблицы 2  и 3). Последовательности нуклеотидов указанных генов (один экзон и два интрона) были найдены в литературе  и взяты из доступной базы данных GenBank и NCBI.

Амплификацию методом ПЦР на амплификаторе ThermalCycler T100 (Bio-Rad, США) в следующем режиме: 95°С– 4 мин., 40 циклов 95°С – 20 сек., 60°С – 20 сек., 72°С - 20 сек. и финальная элонгация 72°С – 4 минуты. ПЦР-продукт проверяли на электрофорезе в 2,0% агарозном геле в буфере 0,5xTBE.

В дальнейшей работе, полученные амплификаты будут секвенироваться на предмет выявления однонуклеотидных полиморфизмов в генах BMP-2 и LCORL.

Таблица 2 - Праймеры, подобранные для амплификации участка экзона 1 и интронов 1 и 2 гена BMP-2 (4-я хромосома)

Название

Праймеры

Температура отжига, ºC

BMP-2_1_EX

 

F - GGGGAAGAGAAGGCACCAATC

R - GGTTCGTATCCTGGCCATATGTA

60

BMP-2_1_IN

F -CTGCGAGCCCCTTGAAGTAA

R –CCTCCCAGCAACACCTGAG 

60

BMP-2_2_IN

F´-TTTTTCCAGACACGCACCAC

R´-AGCACTGTAAATGTAGTGCCCA 

60

Таблица 3 - Праймеры, подобранные для амплификации экзонных участков гена BMP-2 (24 хромосома)

Название

Праймеры

Температура отжига, ºC

1BMP2_24

F - TACTCGGAGGTGCTTTTCGG

R –AAGCGTTCCGTTTCCTCTTCT 

60

2BMP2_24

F -TTCCCATTACCGGCATCCAC

R –GAGAACCTCTGACACTGCCC 

60

3BMP2_24

F´-TGCTCATCCTGTCCCAGAGA

R´-GGTCCCCATCTCCTTCAACG 

60

3. Основные результаты

Все изученные размерно-весовые характеристики производителей были сведены в таблицы (см. таблицы 4 и 5).  Промеры потомков измеряли каждый месяц в течение полугода, полные данные содержатся в базе данных в Excel. Наблюдалась выраженная вариация по всем признакам, что является характерным как для индивидуальных особей-производителей, так и для растущего потомства радужной форели.

Таблица 4 - Характеристика самцов ропшинской золотой форели

№ п/п

вес г.

длина по Смиту см.

№ проб-ки

объем эякулята мл.

подвижность сек/%

№ ген. пробы

№ самки (Бонитировочный номер)

1

585

34,2

1

7

34/100

1

283

2

680

36

2

3,2

28/100

2

281

3

430

29,7

3

3,4

32/100

3

280

4

595

34,3

4

3,4

25/100

4

284

5

895

39,6

5

6,8

27/100

5

285

6

665

36,4

6

5,5

28/100

6

286

7

540

33,3

7

6,2

23/100

7

287

8

390

29,1

8

6

25/100

8

288

9

600

34

10

6,6

23/100

9

290

10

515

33,8

12

3,4

27/100

10

289

11

560

33,1

13

5,8

28/100

11

294

12

925

38

14

4,4

25/100

12

297

13

850

39,5

15

4

23/100

13

293

14

645

36,5

16

3,1

27/100

14

298

15

580

34,3

17

4

28/100

15

292

16

675

35,1

19

15

28/100

16

295

17

590

33,7

20

3,2

27/100

20

300

Среднее

620

34,595

5,25

26,7

Ошибка средней

31,02842

0,600

0,602

0,637

Медиана

592,5

34,25

4,8

27

Мода

#Н/Д

34,3

3,4

28

Стандартное отклонение

138,7633

2,684

2,694

2,848

Дисперсия выборки

19255,26

7,208

7,257

8,116

Эксцесс

0,711497

0,496

9,066

1,306

Асимметрич-ность

0,83618

-0,0218

2,616

0,838

Интервал

535

10,5

12,2

11

Минимум

390

29,1

2,8

23

Максимум

925

39,6

15

34

Сумма

12400

691,9

105

534

Счет

17

17

17

17

Таблица 5 - Характеристика самок ропшинской золотой форели

№ самки

Масса рыбы, г.

Длина см.

тела по Смиту

Длина чешуйчатого покрова

Головы

Высота тела, см.

Толщина тела, см.

Масса икры, г.

Кол-во икринок в 5 г., шт.

Масса 1 икринки, мг.

280

2290

49

44,2

8,9

15,1

6,8

216

89

56

281

3265

56,5

51,9

10,5

16,8

7,2

332

92

54

283

3410

65

51,1

10,5

17,5

7,8

394

83

60

284

2850

52,9

48,1

11,1

16,5

7,7

380

89

56

285

3390

54,1

50

10,1

16,1

7,6

398

90

56

286

3610

59,9

55,2

11,4

17,5

7,2

316

82

61

287

3530

56,9

52,2

10,7

17,2

7,9

346

89

56

288

3650

56,2

51,9

10,4

17,1

8,1

388

81

62

289

3590

53

48,2

10,3

18

8,2

296

90

56

290

3055

54,8

52

10,5

17,2

6,8

368

99

51

292

3655

56,4

55,5

11,4

18,1

7,8

312

108

49

293

3400

55,2

50,6

11,7

17

7,6

320

81

62

294

3775

60,9

56,6

11,8

17,2

7,8

372

74

68

295

3800

60

55,7

11,4

17

8

378

86

58

297

3565

53,1

49,1

9,7

15,1

6,8

298

103

49

298

4440

60,9

56,1

11,4

18,1

8,1

378

87

57

300

3150

53,2

51,1

10,8

17,7

7,6

450

89

56

Среднее

3418

56,46

51,885

10,76

17,02

7,53

342,3

88,35

57,8

Стандартная ошибка

109,774

0,897

0,787

0,164

0,200

0,109

12,368

1,878

1,135

Медиана

3470

56,3

51,9

10,75

17,15

7,65

351

89

56,5

Мода

#Н/Д

60,9

51,9

11,4

17,2

7,8

378

89

56

Стандартное отклонение

490,926

4,010

3,519

0,734

0,897

0,486

55,312

8,400

5,074

Дисперсия выборки

241008,947

16,085

12,383

0,539

0,805

0,236

3059,484

70,555

25,747

Эксцесс

1,042

-0,314

-0,328

0,559

0,359

-1,090

0,389

0,589

-0,133

Асимметричность

0,434

0,286

-0,218

-0,746

-0,850

-0,500

-0,459

0,607

0,084

Интервал

2150

16

13,5

2,9

3,1

1,5

234

34

19

Минимум

2290

49

44,2

8,9

15,1

6,7

216

74

49

Максимум

4440

65

57,7

11,8

18,2

8,2

450

108

68

Сумма

68360

1129,2

1037,7

215,2

340,4

150,6

6846

1767

1156

Счет

17

17

17

17

17

17

17

17

17

Выборочные данные по размерно-весовым характеристикам, касающиеся первых четырех пар производителей, в качестве примера, представлены в таблице 6. Это данные, включающие последнюю бонитировку от 10.09.2021 (см. таблицу 6).

Таблица 6 - Размерно-весовые показатели потомков за 6 месяцев от 4-х пар производителей ропшинской золотой форели

Размерно-весовые показатели потомков

♀  -  ♂

♀  -  ♂

♀  -  ♂

♀  -  ♂

284 - 4

286 - 6

288 - 8

290 - 9

Масса тела 30 дней

0,15±0,00

0,19±0,02

0,18±0,02

0,17±0,02

Масса тела 60 дней

2,03±0,32

2,26±0,36

2,21±0,33

2,03±0,38

Масса тела 90 дней

7,17±2,02

8,67±2,9

8,38±2,41

7,89±2,42

Масса тела 120 дней

10,76±3,37

12,09±3,81

11,77±3,86

10,99±2,96

Масса тела 150 дней

16,69±4,75

18,93±4,54

17,01±5,28

16,34±5,06

Масса тела 180 дней

18,80±4,95

21,15±5,11

19,18±6,07

18,12±5,66

Длина по Смиту 30 дней

2,17±0,09

2,45±0,11

2,38±0,11

2,24±0,09

Длина по Смиту 60 дней

2,82±0,11

3,19±0,13

3,11±0,12

2,91±0,12

Длина по Смиту 90 дней

4,41±0,49

4,97±0,56

4,83±0,54

4,54±0,51

Длина по Смиту 120 дней

6,31±0,71

7,11±0,81

6,91±0,77

6,49±0,73

Длина по Смиту 150 дней

9,27±1,04

10,05,1,13

9,86±1,11

9,46±1,06

Длина по Смиту 180 дней

10,29±1,15

11,15±1,25

10,94±1,22

10,50±1,17

Дл. до конца чешуйчатого покрова 30 дн.

1,97±0,08

2,22±0,09

2,16±0,09

2,03±0,09

Дл. до конца чешуйчатого покрова 60 дн.

2,55±0,11

2,89±0,12

2,80±0,12

2,64±0,11

Дл. до конца чешуйчатого. покрова 90 дн.

4,07±0,44

4,59±0,51

4,45±0,48

4,19±0,46

Дл. до конца чешуйчатого покрова 120 дн.

5,81±0,63

6,56±0,71

6,36±0,69

5,99±0,65

Дл. до конца чешуйяатого покрова 150 дн.

8,56±0,93

9,27±1,01

9,09±0,99

8,73±0,95

Дл. до конца чешуйчатого покрова 180 дн.

9,49±1,03

10,29±1,12

10,09±1,10

9,69±1,06

Длина головы 30 дней

0,40±0,05

0,45±0,06

0,44±0,06

0,41±0,05

Длина головы 60 дней

0,52±0,07

0,59±0,08

0,57±0,07

0,54±0,07

Длина головы 90  дней

0,81±0,11

0,91±0,13

0,88±0,12

0,83±0,11

Длина головы 120 дней

1,15±0,16

1,31±0,18

1,26±0,17

1,19±0,16

Длина головы 150 дней

1,70±0,23

1,84±0,26

1,81±0,25

1,73±0,24

Длина головы 180 дней

1,88±0,25

2,04±0,27

2,00±0,27

1,92±0,26

Высота тела 30 дней

0,40±0,07

0,46±0,07

0,44±0,07

0,42±0,07

Высота тела 60 дней

0,53±0,09

0,59±0,11

0,58±0,09

0,54±0,09

Высота тела 90 дней

1,12±0,21

1,27±0,24

1,23±0,23

1,16±0,22

Высота тела 120 дней

1,61±0,30

1,82±0,34

1,76±0,33

1,66±0,31

Высота тела 150 дней

2,37±0,45

2,57±0,48

2,52±0,47

2,42±0,45

Высота тела 180 дней

2,62±0,49

2,84±0,53

2,79±0,52

2,68±0,50

Толщина тела 30 дней

0,23±0,05

0,26±0,05

0,,25±0,05

0,23±0,05

Толщина тела 60 дней

0,34±0,07

0,39±0,08

0,37±0,07

0,35±0,07

Толщина тела 90 дней

0,64±0,10

0,70±0,11

0,68±0,11

0,66±0,10

Толщина тела 120 дней

0,78±0,12

0,88±0,14

0,86±0,13

0,81±0,12

Толщина тела 150 дней

1,15±0,18

1,25±0,19

1,23±0,19

1,18±0,18

Толщина тела 180 дней

1,26±0,19

1,37±0,21

1,34±0,21

1,29±0,19

Средние размерно-весовые  показатели по  50-ти потомкам от каждой из восьми  пар производителей рассчитывали по данным бонитировки. Бонитировка потомства проводилась ежемесячно  в течение полугода.

4. Заключение

Таким образом, были отобраны пары производителей форели ропшинская золотая и сняты их размерно-весовые показатели.  От восьми пар производителей было получено потомство, от каждой семьи брали по 50 особей, которых бонитировали ежемесячно в течении полугода и на этой основе создана соответствующая база данных. Подобраны праймеры для амплификации участков гена BMP-2.

Article metrics

Views:1926
Downloads:6
Views
Total:
Views:1926