Pages Navigation Menu

ISSN 2227-6017 (ONLINE), ISSN 2303-9868 (PRINT), DOI: 10.18454/IRJ.2227-6017
ПИ № ФС 77 - 51217, 16+

DOI: https://doi.org/10.23670/IRJ.2017.65.107

Скачать PDF ( ) Страницы: 85-89 Выпуск: № 11 (65) Часть 3 () Искать в Google Scholar
Цитировать

Цитировать

Электронная ссылка | Печатная ссылка

Скопируйте отформатированную библиографическую ссылку через буфер обмена или перейдите по одной из ссылок для импорта в Менеджер библиографий.
Пахратдинова Ж. У. ИЗУЧЕНИЕ ГЕНЕТИЧЕСКИХ ОСНОВ УСТОЙЧИВОСТИ СОРТОВ ОГУРЦА К ПЕРОНОСПОРОЗУ НА ОСНОВЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МАРКЕРОВ / Ж. У. Пахратдинова, А. С. Рсалиев, Н. Т. Амирханова // Международный научно-исследовательский журнал. — 2018. — № 11 (65) Часть 3. — С. 85—89. — URL: https://research-journal.org/biology/izuchenie-geneticheskix-osnov-ustojchivosti-sortov-ogurca-k-peronosporozu-na-osnove-molekulyarno-geneticheskix-markerov/ (дата обращения: 26.01.2021. ). doi: 10.23670/IRJ.2017.65.107
Пахратдинова Ж. У. ИЗУЧЕНИЕ ГЕНЕТИЧЕСКИХ ОСНОВ УСТОЙЧИВОСТИ СОРТОВ ОГУРЦА К ПЕРОНОСПОРОЗУ НА ОСНОВЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МАРКЕРОВ / Ж. У. Пахратдинова, А. С. Рсалиев, Н. Т. Амирханова // Международный научно-исследовательский журнал. — 2018. — № 11 (65) Часть 3. — С. 85—89. doi: 10.23670/IRJ.2017.65.107

Импортировать


ИЗУЧЕНИЕ ГЕНЕТИЧЕСКИХ ОСНОВ УСТОЙЧИВОСТИ СОРТОВ ОГУРЦА К ПЕРОНОСПОРОЗУ НА ОСНОВЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МАРКЕРОВ

Пахратдинова Ж.У.1, Рсалиев А.С.2, Амирханова Н.Т.3

1ORCID: 0000-0003-3142-3885, магистр естественных наук, 2кандидат сельскохозяйственных наук, 3кандидат биологических наук, Научно-исследовательский институт проблем биологической безопасности,пгт. Гвардейский, Жамбылская область, Кордайский район, Республика Казахстан

ИЗУЧЕНИЕ ГЕНЕТИЧЕСКИХ ОСНОВ УСТОЙЧИВОСТИ СОРТОВ ОГУРЦА К ПЕРОНОСПОРОЗУ НА ОСНОВЕ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИХ МАРКЕРОВ

Аннотация

Пероноспороз – является одним из наиболее вредоносных болезни огурца.В настоящее время пероноспороз распространён во всех регионах мира и поражает огурец, как в открытом, так и в защищённом грунте, в том числе и в Казахстане. Наиболее практичным и экономичным подходом в борьбе с пероноспорозом огурца является использование генетически устойчивых сортов к болезни. В связи этим в статье приведены данные молекулярного скрининга 30 сортов и гибридов огурца с целью выявления носителей эффективных Dmгенов устойчивости к пероноспорозу. Молекулярный скрининг показал наличие у 3 образцов огурца гена устойчивости Dm1.1, у 16 образцов – Dm5.1, у 10 образцов – Dm5.3. В результате был создан исходный селекционный материал огурца, включающий сорта и гибриды огурца с генами устойчивости к пероноспорозу.

Ключевые слова: огурцы, пероноспороз, Dm-гены, устойчивость, ДНК-маркеры.

Pakhratdinova Zh.U.1, Rsaliev A.S.2, Amirkhanova N.T.3

1ORCID: 0000-0003-3142-3885, Master of Science in Natural Sciences, 2PhD in Agriculture, 3PhD in Biology, Scientific Research Institute for Biological Safety Problems, Gvardeyskiy settlement, Zhambyl Oblast, Kazakhstan

STUDY OF THE GENETIC BASES OF THE RESISTANT OF CUCUMBER VARIETIES TO DOWNY MILDEW ON THE BASIS OF MOLECULAR GENETIC MARKERS

Abstract

Downy mildew is one of the most harmful diseases of cucumber. Currently, downy mildew is widespread in all regions of the world and affects the cucumber, both in open and in protected ground, including in Kazakhstan. The most practical and economical approach in the fight against downy mildew of cucumber is the use of varieties that genetically resistant to the disease. In this regard, the article presents data on molecular screening of 30 varieties and hybrids of cucumber in order to identify carriers of effective Dm-genes for resistance to downy mildew. Molecular screening showed the presence of a Dm1.1 resistance gene in 3 cucumber samples, Dm5.1 in 16 samples, and Dm5.3 in 10 samples. As a result, the initial cucumber selection material was created, including varieties and hybrids of cucumber with genes resistant to downy mildew.

Keywords: cucumbers, downy mildew, Dm-genes, resistance, DNA markers.

Введение

В настоящее время среди известных болезней огурца наиболее опасным и вредоносным является пероноспороз или ложная мучнистая роса. Возбудителем патогена является облигатный гриб Pseudoperonospora cubensis Rostowz, поражающий огурец в любом возрасте от 5-6 настоящих листьев и до конца вегетации. Патоген очень быстро распространяется и может заражать все растения на одном поле за 5-6 дней [1, С. 17], [2, С. 10-13], [3, С. 27-40]. Вредоносность заболевания наиболее высока в период цветения – плодоношения и может в короткие сроки – за 3-4 дня полностью погубить растения, как в теплицах, так и в открытом грунте [4, С. 42], [5, С. 37], [6, С. 55].

Наиболее практичным и экономичным подходом в борьбе с пероноспорозом огурца является использование сортов огурца с эффективными генами устойчивости к болезни. Гены устойчивости к пероноспорозу обозначаются символом «Dm» – от английского названия Downy mildew. В настоящее время эффективными генами устойчивости к болезни огурца являются гены Dm1.1, Dm5.1, Dm5.3 [7, С. 105-110], [8, С. 467-471].

До настоящего времени в Казахстане не проводились научные работы по выявлению доноров устойчивости огурца к этой болезни и не определялись возможности использование доноров устойчивости в селекции огурца. В связи этим целью данной работы было использование молекулярно-генетических методов для выявления сортов и гибридов огурца с эффективными Dm-генами устойчивости, которые в дальнейшем может быть использованы как доноры устойчивости в селекционных программах, направленных на создание новых сортов, устойчивых к болезни.

Материалы и методыисследований

Растительные материалы. Материалами исследований являются коммерческие и коллекционные сорта и гибриды огурца из разной селекции, полученные из генофонда овощных культур Казахского научно-исследовательского института картофелеводства и овощеводства (КазНИИКО). По происхождению представляют собой различные регионы мира, в том числе Казахстан, Россия, Голландия, США и другие страны. В общей сложности было тестировано 30 образцов огурца: Азат, Анушка F4, Анушка F5, Анушка F6, Семиреченский, Медеу, Мейрам 20, Жигер (Казахстан), Nadine F1, Santana F1, Danish pickling, Dolibor F1, Donja F1, Atlantis F1, Alert F1, Alvin F1, Alstar F1, Claudia F1 (Нидерланды), Nimbus H-1262 (Молдова), Libella F1 (Германия), Calypso F1, Camanon Wahaslihe, Parker, Bush champion (США), Natsufushinari (Китай), 607 F1 (Турция), Алтай, Росинка, Парад и Феникс (Россия).

Для проведения молекулярного скрининга использованы ДНК-маркеры, тесно сцепленные с эффективными генами устойчивости к пероноспорозу огурца [9, 10]. Характеристики ДНК маркеров для идентификации аллельного состояния генов устойчивости представлены в таблице 1.

 

Таблица 1 – Характеристики ДНК маркеров для идентификации аллельного состояния генов устойчивости к пероноспорозу

Ген Маркер Последовательность Размер ПЦР продукта, п.н.
Dm1.1 SSR31116_F GAAGGCCATCAAGGTATTACATCT 220
SSR31116_ R CAAACCTTCTACATGATCTTAATCTTT
Dm5.1 CAPs_ENK60_F GAATAGATAGGCTACACTTT 490
CAPs_ENK60_R GTATAAAACTTGAGTGAATT
Dm5.3 SSR00772_F AGAAGCGTTGGGGGAAAATA 172
SSR00772_ R TGCTACCTCACATGGTTTTG

 

Постановка ПЦР. Реакционный состав и температурно-временные режимы подбирали согласно аннотации, прилагаемой к ферменту и характеристикам праймеров. Для амплификации со всеми праймерами в общем объеме 20мкл готовили смесь, содержащую 50 нг геномной ДНК ячменя, 5 units/µl Taq DNA polymerase (Sigma Aldrich, USA), dNTP mix with dTTP 10 mM (Applied biosystems, Warrington, UK), 10×PCR buffer with MgCl2 (Sigma Aldrich, USA), 10 пмоль каждого праймера и Distilled water DNase/RNase free (Gibco, USA). При этом условия проведения амплификации были индивидуальными для каждого праймера. В качестве положительного контроля использовали источники генов устойчивости к пероноспорозу огурца, а отрицательным контролем служила деионизированная вода. Наработку специфических участков ДНК проводили в термоциклере «Termocycler-Pro» (Eppendorf, Германия).

Электрофоретический  анализ  продуктов  амплификации. Выявление продукта ПЦР проводилось при помощи электрофореза в 1,5 % агарозном геле (iNtRON, Biotechnology Grade). Разделение амплифицированных фрагментов выполняли в электрофорезной камере (Scie-Plas, Великобритания) в ТВЕ буфере с добавлением бромистого этидия в течение 1,5 часов при напряжении электрического поля 80 V. Анализ результатов электрофореза проводились с использованием гель-документирующей системы «MiniBIS Pro, Израиль» c программным обеспечением Gel Capture и Gel Quant Express. Определение длин амплифицированных фрагментов проводилось по сравнению с ДНК – маркерами «50 bp DNA Ladder» и «100 bp DNA Ladder» (Invitrogen Corporation).

Результаты исследований

Генотипирование образцов огурца проводили с целью выявления носителей эффективных генов устойчивости к пероноспорозу. В общей сложности было тестировано 30 образцов огурца. Далее в их геноме с помощью ДНК-маркеров на основе ПЦР определяли присутствие следующих генов устойчивости к ложной мучнистой росе – Dm1.1, Dm5.1, Dm5.3.

Для выявления носителей гена устойчивости Dm1.1 молекулярный скрининг проводили с помощью маркера SSR31116. Результаты ПЦР анализа показали, что у образцов Dolibor F1, Alert F1 и Феникс присутствует специфический продукт амплификации с молекулярным весом 220 п.н., аналогичный по размеру ПЦР-продукта положительного контроля Dm1.1. Остальные исследованные сорта несут рецессивную аллель гена. При этом фитопатологический и молекулярный скрининг выявил идентичность гена устойчивости указанных генотипов огурца, определяющих устойчивость к болезни. Благодаря наличию данного гена в сортах огурца гриб обладает низкий уровень споруляции и проявляет небольшой некротические поражения тканей, потемнение и быстрый гибель клеток, данный случай свидетельствует о классической реакции гиперчувствительности гена. Результаты этих исследований представлены на рисунке 1.

06-02-2018 17-26-40

Рис. 1 – Молекулярный скрининг сортов огурца для идентификации носителей гена устойчивости Dm1.1

М-маркер DNA Ladder, П.к-положительный контроль,О.к.-отрицательный контроль, 1-Азат, 2-Алтай, 3-Анушка F4, 4-Анушка F5,5-Анушка F6, 6-Росинка, 7-Семиреченский, 8-Медеу, 9-Мейрам 20,10-Жигер, 11-Nadine F1, 12-Santana F1, 13-Danish pickling, 14-Dolibor F1,15-Donja F1, 16-Atlantis F1, 17-Alert F1, 18-Alvin F1, 19-Alstar F1,20-Claudia F1, 21-Nimbus H-1262, 22-Libella F1, 23-Calypso F1, 24-Camanon Wahaslihe, 25-Parker, 26-Natsufushinari, 27-607 F1, 28-Bush champion, 29-Парад, 30-Феникс

 

При использовании праймера CAPs_ENK60 продукт амплификации размером 490 п.н. указывал на доминантные аллели гена устойчивости Dm5.1. В результате ПЦР, специфический продукт нарабатывался на следующих сортах и гибридах огурца: Азат, Анушка F5, Анушка F6, Мейрам 20, Медеу, Donja F1, Atlantis F1, Alvin F1, Alstar F1, Santana F1, Parker, Natsufushinari, 607 F1, Bush champion, Росинка и Парад (рис. 2). При этом эти отмеченные сорта имели высокую степень устойчивости в полевых условиях на фоне искусственного заражения и у них выявлен высокий  уровень  возрастной устойчивости.

06-02-2018 17-30-20

Рис. 2 – Молекулярный скрининг сортов огурца для идентификации носителей гена устойчивости Dm5.1

М-маркер DNA Ladder, П.к.-положительный контроль, О.к.-отрицательный контроль, 1-Азат, 2-Алтай, 3-Анушка F5, 4-Анушка F6, 5-Росинка, 6-Мейрам 20, 7-Медеу, 8-Анушка F4, 9-Семиреченский, 10-Жигер, 11-Donja F1, 12-Atlantis F1, 13-Alvin F1, 14-Alstar F1,15-Santana F1, 16-Dolibor F1, 17-Nadine F1, 18-Alert F1, 19-Danish pickling, 20-Camanon Wahaslihe, 21-Parker, 22-Natsufushinari, 23-607 F1, 24-Bush champion, 25-Libella F1, 26-Парад, 27-Claudia F1, 28-Calypso F1, 29-Nimbus H-1262, 30-Феникс

 

Для выявления носителей гена устойчивости Dm5.3 нами был использован специфичный праймер SSR00772. В результате эксперимента, характерный фрагмент амплификации в размере 172 п.н. обнаружен у сортов и гибридов Азат, Алтай, Анушка F4, Жигер, Nadine F1, Nimbus H-1262, Calypso F1, Camanon Wahaslihe, Danish pickling, Claudia F1. На основе полученных результатов можно предположить, что отмеченные сорта являются носителями гена устойчивости Dm5.3. Ген dm5.3 относится к наиболее распространенному классу R-генов устойчивости растений – NBS-LRR, кодирующих белки, в структуру которых входит нуклеотид-связывающий домен – nucleotide binding site, а также рецепторная область, богатая лейцином – leucine rich repeat. Хотя, данный ген еще широко не используется в селекции, в связи, с чем он должен играть определенную роль при создании новых сортов и гибридов огурца в комбинации с другими генами. Результаты показаны на рисунке 3.

 

06-02-2018 17-31-22

Рис. 3 – Молекулярный скрининг сортов огурца для идентификации носителей гена устойчивости Dm5.3

М-маркер DNA Ladder, П.к.-положительный контроль, О.к.-отрицательный контроль, 1-Азат, 2-Алтай, 3-Анушка F4, 4-Анушка F5, 5-Анушка F6, 6-Росинка, 7-Семиреченский, 8-Медеу, 9-Мейрам 20, 10-Жигер, 11-Nadine F1, 12-Santana F1, 13-Parker, 14-Dolibor F1, 15-Donja F1, 16-Atlantis F1, 17-Alert F1, 18-Alvin F1, 19-Alstar F1, 20-607 F1, 21-Nimbus H-1262, 22-Libella F1, 23-Calypso F1, 24-Camanon Wahaslihe, 25-Danish pickling, 26-Natsufushinari, 27-Claudia F1, 28-Bush champion, 29-Парад, 30-Феникс

 

Вывод. Таким образом, с использованием ДНК-маркеров генотипировано 30 сортов и гибридов огурца к пероноспорозу. При этом молекулярный скрининг показал наличие у 3 образцов огурца (Dolibor F1, Alert F1 и Феникс) гена устойчивости Dm1.1, у 16 сортов и гибридов огурца гена устойчивости Dm5.1, у 10 образцов  (Азат, Алтай, Анушка F4, Жигер, Nadine F1, Nimbus H-1262, Calypso F1, Camanon Wahaslihe, Danish pickling, Claudia F1) – Dm5.3, соответственно. Следует отметить, что у сорта Азат обнаружены два гена устойчивости Dm5.1 и Dm5.3. В результате проведенных исследований был создан исходный селекционный материал, который представляют собой ценный исходный материал, и может быть использован как доноры в селекционных программах, направленных на создание новых сортов и гибридов огурца, устойчивых к болезни.

Список литературы / References

  1. Costache M. Effect of root zone temperature on infection, sporulation and symptom development cubensis / M.Costache, P. Varadie // Bull. Acad. sci. agr. Etol forest. –1991. – № 6. – 17 р.
  2. Μаnole N. On host families and genera of Peronospora downy mildews and on geographic proclivities of the pathogens / N. Μаnole // Cere. agran. Moldova. –1991. – Р.10-13.
  3. Cohen Y. Ultrastructure of cubensis muskmelon genotypes susceptible and resistant to downy mildew / Y. Cohen, H.Eyal // Physiological Plant Pathology. –1989. – №1. – Р. 27-40.
  4. Тимченко В.И. Биологические особенности возбудителя ложной мучнистой росы огурца / В.И. Тимченко, Ю.А. Михайлов // Защита растений. – 1989. – № 3.– 42 с.
  5. Корганова Н.Н. Вредители и болезни огурца / Н.Н. Корганова // Защита и карантин растений. – 2001. – № 7. – 37 с.
  6. Цупкова Н.А. Для садовода и овощевода любителя / Н.А. Цупкова // Защита и карантин растений. – 1988. – № 6. – 55 с.
  7. Налобова В.Л. Подбор исходного материала для селекции короткоплодных сортов и гибридов огурца корнишонного типа / В.Л. Налобова // Овощеводство. – Минск, 2008. – Вып. 14.– С. 105-110.
  8. Lebeda A., Doležal K. Peroxidase isozyme polymorphism as a potential marker for detection of field resistance in Cucumis sativus to cucumber downy mildew (Pseudoperonospora cubensis (Berk. et Curt.) Rostov.) / A. Lebeda, K. Doležal // Journal of Plant Diseases and Protection. – 1995. – Vol.102. – P.467-471.
  9. Methods and compositions for identifying downy mildew resistant cucumber plants EP 2491147 A1 // Seminis Vegetable Seeds, Inc. WO2009129314A2, Oct 22. – 2009. USA.
  10. Downy mildew resistant cucumber plants 2491147 A1 // Seminis Vegetable Seeds, Inc. WO2009129314A2, Oct 22, 2009. USA.

 Список литературы на английском языке / References in English

  1. Costache M. Effect of root zone temperature on infection, sporulation and symptom development cubensis / M. Costache, P. Varadie // Bull. Acad. sci. agr. Etol forest. –1991. – № 6. – 17 р.
  2. Μаnole N. On host families and genera of Peronospora downy mildews and on geographic proclivities of the pathogens / N. Μаnole // Cere. agran. Moldova. –1991. – Р.10-13.
  3. Cohen Y. Ultrastructure of cubensis muskmelon genotypes susceptible and resistant to downy mildew / Y. Cohen, H.Eyal // Physiological Plant Pathology. –1989. – №1. – Р. 27-40.
  4. Timchenko V.I. Biologicheskie osobennosti vozbuditelya lojnoi muchnistoi rosy ogurca [Biological features of causative agent of the powdery mildew of cucumber] / V.I. Timchenko, Yu. A. Mikhailov // Zashchita rastenii [Plant Protection]. – 1989. – № 3. – 42 p. [in Russian]
  5. Korganova N.N. Vrediteli I bolezni ogurca [Pests and diseases of cucumber] / N.N. Korganova // Zashchita I karantin rastenii [Plant protection and quarantine]. – 2001. – № 7. – 37 p. [in Russian]
  6. Tsupkova N.А. Dlya sadovoda I ovoshchevoda lubitelya [For the amateur gardener and vegetable grower] / N.А. Tsupkova // Zashchita I karantin rastenii [Plant protection and quarantine]. – 1988. – № 6. – 55 p. [in Russian]
  7. Nalobova V.L. Podbor ishodnogo materiala dlya selekcii korotkoplodnyh sortov I gibridov ogurca kornisnnogo tipa [Selection of initial material for selection of short-fruited varieties and hybrids of cucumber of cornichon type] / Nalobova V.L. // Оvоshchevodstva [Vegetable growing]. – Minsk, 2008. – Edit. 14. – P. 105-110. [in Russian]
  8. Lebeda A., Doležal K. Peroxidase isozyme polymorphism as a potential marker for detection of field resistance in Cucumis sativus to cucumber downy mildew (Pseudoperonospora cubensis (Berk. et Curt.) Rostov.) / A. Lebeda, K. Doležal // Journal of Plant Diseases and Protection. – 1995. – Vol.102. – P.467-471.
  9. Methods and compositions for identifying downy mildew resistant cucumber plants EP 2491147 A1 // Seminis Vegetable Seeds, Inc. WO2009129314A2, Oct 22. – 2009. USA.
  10. Downy mildew resistant cucumber plants 2491147 A1 // Seminis Vegetable Seeds, Inc. WO2009129314A2, Oct 22, 2009. USA.

Оставить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *

Лимит времени истёк. Пожалуйста, перезагрузите CAPTCHA.